SsDddA activity by protein preparation

Following a 10-minute incubation with SsDddA, reactions containing two different lots of the Stergachis lab SsDddA were stopped using Stergachis lab SsDddI, whereas reactions containing EpiCypher SsDddA were stopped using EpiCypher SsDddI. All subsequent steps were performed according to the standard Targeted DAF-seq protocol.

Targeted DAF-seq median deamination rates by SsDddA production batch

CA10 amplicons (hg38, chr17:51829518-51834396)

Preparation	1 uM	2 uM	4 uM
Stergachis batch1	16%	23%	30%
Stergachis batch2	15%	21%	30%
EpiCypher batch	14%	20%	26%

NAPA amplicons (hg38, chr19:47,514,488-47,518,985)

Preparation	1 uM	2 uM	4 uM
Stergachis batch1	32%	40%	47%
Stergachis batch2	32%	38%	46%
EpiCypher batch	29%	36%	42%

PCR primers and reaction conditions

CA10 region (hg38, chr17:51829518-51834396)

Primers
Forward: AAGGAGTCATGAGGGACGTATGCAA
Reverse: AGGCAGGTCCATGAAGAGTGTCCATT
Amplicon length: 4878 bp

PCR mix
SsDddA-treated DNA(~30-50ng)
1.5 μL 5 μM Forward primer
1.5 μL 5 μM Reverse primer
25 μl. repliQa HiFi ToughMix(2X) (Qunatabio; Part No:95200-100)
Water to 50 μl

Thermocycling protocol

98 C, 30s
98 C, 10s
66 C, 5s
68 C, 25s
Go to step 2, 29x for 30 cycles total
68 C, 1 min
hold at 4 C

NAPA region (hg38, chr19:47,514,488-47,518,985)

Primers
Forward: TCCCCTCCAARRCTTCAR
Reverse: CAACCCCCRCAACCTATCA
Amplicon length: 4498 bp

PCR mix
SsDddA-treated DNA(~30-50ng)
3 μL 5 μM Forward primer
3 μL 5 μM Reverse primer
25 μl. repliQa HiFi ToughMix(2X) (Qunatabio; Part No:95200-100)
Water to 50 μl